Glucose absorption in the duodenum is modulated by an estrogen receptor α-dependent regulation of glucose transporter functional expression


Materials and methods

Oral glucose tolerance test in human participants

Healthy Chinese women aged 20–30 years with regular menstrual cycles (menstrual period within 3–7 days, menstrual cycle in the range of 25–32 days) and without lesions or medical conditions causing irregular menstruation were included. Research on healthy human volunteers was conducted in accordance with the principles of the Declaration of Helsinki. Oral glucose tolerance test (OGTT) was performed during the menstrual and ovulation periods, when the estrogen level in the body was the lowest and highest, respectively. Before the measurements, all participants were required to fast for 12 hours. After fasting and intake of 75 g oral glucose, peripheral blood samples were collected at 5, 15, 30, 45, 60, 75 and 90 min, and blood glucose levels were measured using a blood glucose meter (Accu-Chek, Roche Diagnostics, Germany). For each participant, the area under the curve (AUC) was calculated to quantify the response to an oral glucose load.

Establishment of an ovariectomized animal model

C57BL/6 female mice, 6 weeks old (~17±2.2 g), were purchased from Beijing Huafukang Biotechnology, China, and housed in the experimental animal facility at Zunyi Medical University under standard care conditions. Sexually mature female mice (n=60) were randomly assigned to two groups and subjected to either ovariectomy (ovariectomized (OVX)) or a sham operation (control), following anesthesia induced by intraperitoneal injection of 50 mg/kg ketamine and 10 mg/kg xylazine. The backs and sides of the mice were shaved and cleaned with 70% ethanol and betadine. Ovaries were removed through a dorsal incision made between the dorsal hump and the base of the tail. A ligature was placed before excising the ovary. The muscle and the skin incisions were closed with sutures. The procedures were repeated for the second ovary.9 Daily weight was recorded for all mice from the second postoperative day until 2 weeks after the operation. All animal experiments were approved by the Committee on Investigations Involving Animals at Zunyi Medical University, China (KLLY(A)-2019-105) in strict accordance with the Guidelines of the Committee on the Care and Use of Laboratory Animals and the Guidelines of Animal Research: Reporting of In Vivo Experiments.

Determination of serum estradiol

Two weeks after the operation, 10 mice from each of the OVX and the control groups were randomly selected for vena cava blood collection, and serum estradiol (E2) levels were detected using a rabbit anti-E2 antiserum radioimmunoassay kit (Beijing Northern Institute of Biotechnology; detection range 20–4000 pg/mL; sensitivity 15 pg/mL), according to the manufacturer instructions.

Murine OGTT

Two weeks after surgery, 10 mice were randomly selected from each of the two groups (distinct from those used in the radioimmunoassay). Following a 12-hour fast, glucose (3 g/kg) was administered via gavage. Blood was collected from the tail vein at 0, 5, 15, 30, 45, 60, 75, and 90 min, and blood glucose levels and AUCs were determined as described for human participants. Following the experiment, mice were euthanized by cervical dislocation, and the duodenum was harvested for subsequent Ussing chamber experiments.

Determination of homeostatic model assessment of insulin resistance

Two weeks postoperation, six mice from both the OVX and control groups were randomly selected to assess insulin resistance. Fasting blood glucose (FBG) levels were determined in overnight-fasted animals using an automatic glucose meter (Accu-Chek, Roche Diagnostics) with blood samples collected from the tail tip. Overnight-fasted animals were anesthetized with ketamine/xylazine (100/10 mg/kg intraperitoneally), and blood samples were obtained from the cardiac ventricle. Serum was separated by centrifugation (800×g, 4°C, 20 min), and plasma insulin concentrations were determined using an ELISA kit (Abcam, Shanghai, China; detection range 6.25–400 µlU/mL, sensitivity 5 µlU/mL). The homeostatic model assessment of insulin resistance (HOMA-IR) index was calculated as: HOMA-IR=(fasting glucose [mmol/L]×fasting insulin [µlU/mL])/22.5.

Ussing chamber experiments

Glucose absorption was measured ex vivo using Ussing chamber experiments in mouse duodenum, as previously described.10 Approximately 1.5 cm of proximal duodenum was placed in ice-cold iso-osmolar mannitol (10 mmol/L) solution and indomethacin (1 μM) solution (to suppress trauma-induced prostaglandin release) at 4°C. The intestinal segment was placed on a flat paraffin block, with a sealing membrane on its surface. The duodenum was opened along the mesenteric border, and the external serosal and muscle layers were removed by sharp dissection in the ice-cold iso-osmolar mannitol and indomethacin solution. The duodenal mucosae were mounted between two chambers (effective penetration area: 0.16 cm2) and placed in an Ussing chamber. Parafilm O-ring was used to minimize edge damage to the tissue, securing between the chamber halves. The mucosa (top) was added to 10 mL of working fluid, with continuous and uniform oxygen (100%) perfusion. The serosal side (basal side) was perfused with 10 mL of working solution, and a mixture of 95% oxygen and 5% carbon dioxide was infused continuously and uniformly. Each bath contained 10.0 mL of the respective solution maintained at 37°C by a heated water jacket. Experiments were performed under continuous short-circuit conditions to maintain the electrical potential difference at zero, except during brief intervals (<2 s) when the open-circuit potential difference was measured. Luminal pH was maintained at 7.40 by the continuous infusion of 0.5 mM HCl under the automatic control of a pH stat system (PHM290, pH-Stat controller; Radiometer Copenhagen). After the assembly, transepithelial short-circuit current (Isc) was recorded every 5 min via an automatic voltage clamp (voltage-current clamp EVC-4000; World Precision Instruments). After stabilization for 15 min, 20 mM glucose solution was added to the mucosal side, and Isc was continuously observed and recorded for 30 min. The changes in Isc were compared. The difference in Isc was used to calculate the tissue absorption index (difference between the highest and lowest values). The mucosal solution used in Ussing chamber experiments contained the following (in mM): 140 Na+, 5.4 K+, 1.2 Ca2+, 1.2 Mg2+, 120 Cl, 25 gluconate, and 10 mannitol. The serosal solution contained the following (in mM): 140 Na+, 5.4 K+, 1.2 Ca2+, 1.2 Mg2+, 120 Cl, 25 HCO3, 2.4 HPO42−, 2.4 H2PO4, and 10 glucose.

Immunohistochemistry

Duodenal tissues from the two groups of mice were fixed in formalin and embedded in paraffin. Immunohistochemistry (IHC) was performed as previously described to stain ERα, ERβ, SGLT1, and GLUT2 in paraffin-embedded tissue blocks11 using 1:50 dilutions of anti-ERα (Abcam, ab32063) and anti-ERβ (Abcam, ab288) and 1:100 dilutions of anti-SGLT1 (Abcam, ab321787) and anti-GLUT2 (Abcam, ab54460). All antibodies were purchased from Abcam. Data were collected from an average of four randomly selected areas in a random section of each tissue sample. The results were analyzed using Image Pro-Plus (Media Cybernetics, USA) and expressed as mean optical density (measured in arbitrary units) for ERα, ERβ, SGLT1, and GLUT2, representing the mean intensity of staining in the considered area.

Experiments in SCBN cells

SCBN cells, a non-transformed duodenal epithelial cell line obtained from a human patient, were provided by Dr Hui Dong of the University of California, San Diego. The cells were frozen in liquid nitrogen. SCBN cells grow as a polarized confluent monolayer and express ERα and ERβ.12 Cells were grown as previously described2 13 in Dulbecco’s Modified Eagle Medium(DMEM) supplemented with 10% fetal calf serum in an incubator with a 5% CO2 at 37°C.

Silencing of ERα or ERβ

To silence ERα or ERβ, lentivirus-based short hairpin RNA (shRNA) was used. SMART vector lentiviral human ERα shRNA (CTCTACTTCATCGCATTCCTT), human ERβ shRNA (CGGCAGACCACAAGCCCAAAT), and SMART vector non-targeting control particles (TTCTCCGAACGTGTCACGT) were purchased from Genechem (Shanghai, China). SCBN cells were transfected according to the manufacturer’s protocol, and western blotting was used to detect protein expression to demonstrate successful silencing.

Western blotting

Murine duodenal mucosal tissues were collected at the time previously described. Normal or ERα or ERβ-silenced SCBN cells were treated with 17β-estradiol (10 nM), protein kinase C (PKC), agonist phorbol 12-myristate 13-acetate(PMA) (200 µM), or PKC inhibitor Gö6976 (200 µM). Duodenal mucosal tissue, pancreatic tissues, or SCBN cells were homogenized in lysis buffer at 4°C. Western blotting for protein expression was performed as previously described.11 Anti-ERα (1:100, Abcam, ab32063), anti-ERβ (1:100, Abcam, ab288), anti-SGLT1 (1:500, Abcam, ab14686), anti-GLUT2 (1:1000, Abcam, ab54460), anti-PKC (1:500, Abcam, ab181558), anti-phosphorylated-PKC (anti-p-PKC) (1:500, Abcam, ab109539), anti-p75 neurotrophin receptor (anti-p75NTR) (1:1000, Abcam, ab52987), anti-cluster of differentiation 36 (anti-CD36) (1:1000, Abcam, ab252922), and anti-glyceraldehyde-3-phosphate dehydrogenase (anti-GAPDH) (1:5000, Abcam, ab8245) were used as primary antibodies and were purchased from Abcam. The results are expressed as a ratio relative to GAPDH.

Statistical analysis

Experimental data were collected and organized per the requirements of a completely randomized controlled design. All data are expressed as the mean±SD. Student’s t-test was generally used to determine the significance of differences between two groups. For multiple comparisons, one-way analysis of variance was used. P<0.05 indicated statistically significant results.



Source link